Journal: Pharmaceutics

Article Title: Bioinspired Silk Fibroin-Based Composite Grafts as Bone Tunnel Fillers for Anterior Cruciate Ligament Reconstruction

doi: 10.3390/pharmaceutics14040697

Figure Lengend Snippet: List of primers for the osteogenic genes of interest.

Article Snippet: A human primary osteogenic sarcoma cell line (SaOs-2, ATCC, Manassas, VA, USA) was used to assess cell behavior in the TGs.

Techniques:

Journal: Pharmaceutics

Article Title: Bioinspired Silk Fibroin-Based Composite Grafts as Bone Tunnel Fillers for Anterior Cruciate Ligament Reconstruction

doi: 10.3390/pharmaceutics14040697

Figure Lengend Snippet: Gene expression profile of osteogenic-related markers. Real-time RT-PCR results of the osteogenic-related transcripts Col Iα, ALP, Runx-2, BMP-2, OCN, OPN and BSP by the SaOs-2 cells cultured in the CTGs and PTGs up to 14 days.(* p < 0.05; ** p < 0.01; *** p < 0.005; **** p < 0.0001).

Article Snippet: A human primary osteogenic sarcoma cell line (SaOs-2, ATCC, Manassas, VA, USA) was used to assess cell behavior in the TGs.

Techniques: Gene Expression, Quantitative RT-PCR, Cell Culture

Journal: Cell chemical biology

Article Title: Lessons in PROTAC design from selective degradation with a promiscuous warhead

doi: 10.1016/j.chembiol.2017.09.010

Figure Lengend Snippet: Key Resources Table

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies c-Abl SantaCruz 23 Arg SantaCruz 81154 Axl Cell Signaling 4939 p-AKT Cell Signaling 4060 CDK4 Cell Signaling 12790 DDR1 SantaCruz 532 EphA2 Cell Signaling 6997 FLAG M2 Sigma F1804 GAPDH Cell Signaling 2118 MerTK Cell Signaling 4319 p38alpha Cell Signaling 9218 p38alpha Cell Signaling 9228 p38delta Cell Signaling 2308 RIPK2 Cell Signaling 4142 c-MET Cell Signaling 8198 SLK Cell Signaling 41255 Src Cell Signaling 2123 CUL2 Invitrogen 700179 VHL Cell Signaling 68547 Tubulin Sigma T9026 HRP linked Mouse IgG GE Life Sciences NA931 HRP Linked Rabbit IgG GE Life Sciences NA934 Chemicals, Peptides, and Recombinant Proteins Cycloheximide Sigma C104450 Epoxomicin Crews laboratory Glutathione Sepharose 4B beads GE Life Sciences 17075601 Ni-NTA agarose QIAGEN 30250 Alpha Glutathione Donor beads PerkinElmer 6765300 Anti-6xHis AlphaLISA Acceptor beads PerkinElmer AL128C Recombinant Human Gas6 Protein R&D Systems 885-GSB-0503 SYPRO Orange Protein Gel Stain Sigma S5692 TRIzol Reagent ThermoFisher 15596018 MAPKAPK2 Protein, Inactive ThermoFisher PV3316 MAPKAPK2 Protein, Inactive ThermoFisher PV3317 Critical Commercial Assays Z′-LYTE Kinase Assay Kit – Ser/Thr 4 Peptide ThermoFisher PV3177 ThermoFisher Experimental Models: Cell Lines MDA-MB-231 ATCC HTB-26 HeLa ATCC CCL-2 Oligonucleotides Tub_F: TGGACTCTGTTCGCTCAGGT Yale School of Medicine N/A Tub_R: TGCCTCCTTCCGTACCACAT Yale School of Medicine N/A p38α_F: TCGCATGAATGATGGACTGAAAT Yale School of Medicine N/A p38α_R: CCCGAGCGTTACCAGAACC Yale School of Medicine N/A Software and Algorithms Image Lab 6.0 BioRad N/A Graphpad Prism N/A Pymol Schrodinger LLC Equipment Synergy 2 microplate reader Biotek Open in a separate window Key Resources Table

Techniques: Recombinant, Staining, Kinase Assay, Software

Journal: Heliyon

Article Title: Mycoplasma hyorhinis infection promotes TNF-α signaling and SMAC mimetic-mediated apoptosis in human prostate cancer

doi: 10.1016/j.heliyon.2023.e20655

Figure Lengend Snippet: M. hyorhinis promotes TNF-α secretion from PCa cells. (A), relative TNF-α secretion levels in M. hyorhinis-contaminated PCa cells (PC3-cM and C4–2B-cM) and mycoplasma-free cells; multiple cancer cells (PC3, C4–2B, DU145, LNCaP, MDA-MB-231, MCF-7, MCF10A, HeLa, MG-63), HDMEC, HF, and DPC via ELISA. (B), experimental design. The parental PCa cells (PC3–P and C4–2B–P) were infected with M. hyorhinis (3 × 107 CFU, 5 MOI) for 2 passages and then passaged twice a week for 6 weeks without further infection (PC3-M and C4–2B-M). For PC3-MF and C4–2B-MF cells, 4 weeks after infection, M. hyorhinis was eliminated in cell cultures for 3 weeks. Seven weeks after infection, in vitro assays and analyses were performed using these PCa cells. (C), relative TNF-α secretion levels in the parental (PC3–P and C4–2B–P) and M. hyorhinis-infected (PC3-M and C4–2B-M) PCa cells. (D), relative TNF-α secretion levels in PC3-M and C4–2B-M and previously infected PCa cells after elimination of M. hyorhinis (PC3-MF and C4–2B-MF). M. hyrorhinis infection was confirmed by Western blotting using specific anti-M. hyorhinis (P70 surface antigen) antibody. βactin was used as a loading control. See full images in Supplementary Figure S4. All results represent mean ± SD values from triplicate assays, and the experiments were repeated three times. **p < 0.0001. HDMEC, human dermal microvascular endothelial cells; HF, human primary fibroblasts; DPC, human primary dental pulp cells; CFU, colony-forming units; MOI, multiplicity of infection.

Article Snippet: Human primary fibroblasts (HF) [ ], human primary dental pulp cells (DPC) [ ], and human cancer cell lines (PC3, C4–2B, DU145, LNCaP, MDA-MB-231, MCF-7, MCF10A, HeLa, MG-63; American Type Culture Collection (ATCC), Manassas, VA) were grown in Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Carsbad, CA) supplemented with 10 % FBS and 1 % penicillin/streptomycin.

Techniques: Enzyme-linked Immunosorbent Assay, Infection, In Vitro, Western Blot

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 1. RP11‑156L14.1 is highly expressed in HSCC tissues and cell lines. (A) The relative expression levels of RP11‑156L14.1 in 30 paired HSCC tumor tissues and adjacent non‑tumor tissues were analyzed by RT‑qPCR. (B) The relative expression levels of RP11‑156L14.1 in HSCC cell lines (FaDu and SAS) and normal tissues were measured by RT‑qPCR. **P<0.01, ***P<0.001. HSCC, hypopharyngeal squamous cell carcinoma; RT‑qPCR, reverse transcrip- tion‑quantitative PCR.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Expressing

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 2. Knockdown of lncRNA RP11‑156L14.1 inhibits cell proliferation and the cell cycle in HSCC cell lines. (A) FaDu cells were transfected with the control vector (si‑Control) or the RP11‑156L14.1‑knockdown vector (si‑RP11‑156L14.1‑1/2/3). The knockdown efficiency was evaluated by RT‑qPCR 48 h later. SAS or FaDu cells were transfected with si‑Control or si‑RP11‑156L14.1. (B and C) Cell proliferation was determined with the CCK‑8 assay at the indicated time‑points. (D) DNA synthesis was measured by EdU staining. (E) A colony formation assay was conducted to evaluate SAS and FaDu cell colony formation capabilities. (F) Flow cytometric analysis of the cell cycle in SAS or FaDu cells stained with propidium iodide. *P<0.05, **P<0.01. lncRNA, long non‑coding RNA; HSCC, hypopharyngeal squamous cell carcinoma; RT‑qPCR, reverse transcription‑quantitative PCR; CCK‑8, Cell Counting Kit‑8.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Knockdown, Transfection, Control, Plasmid Preparation, CCK-8 Assay, DNA Synthesis, Staining, Colony Assay

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 3. Knockdown of lncRNA RP11‑156L14.1 inhibits the migration, invasion, and EMT in HSCC cells. SAS or FaDu cells were transfected with si‑Control or si‑RP11‑156L14.1. (A and B) Cell migration capability was analyzed by wound healing assay. (C and D) A Transwell assay was performed to assess cell migration and invasion in SAS and FaDu cells. (E) EMT‑related proteins E‑cadherin, N‑cadherin, and vimentin and (F) proliferation‑marker Ki67 were determined by western blotting in SAS and FaDu cells. β‑actin was used as an internal control. The experiment was repeated three times, and the representative blot images are presented. *P<0.05, **P<0.01, ***P<0.001. lncRNA, long non‑coding RNA; EMT, epithelial‑mesenchymal transition; HSCC, hypopharyngeal squamous cell carcinoma.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Knockdown, Migration, Transfection, Wound Healing Assay, Transwell Assay, Western Blot, Control

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 4. lncRNA RP11‑156L14.1 directly binds to miR‑548ao‑3p in HSCC cell lines. (A) A subcellular fractionation assay was performed in FaDu or SAS cells. The relative expression levels of RP11‑156L14.1, GAPDH, and U6 in the cytoplasm or nucleus were analyzed by qPCR. (B) FaDu cells were transfected with a luciferase reporter containing the 3'‑UTR of RP11‑156L14.1, in combination with different miRNA mimics or a negative control. The relative luciferase activity was analyzed 48 h later. (C) Bioinformatics analysis predicted putative binding sequences between wt RP11‑156L14.1 and miR‑548ao‑3p. The mutated RP‑11‑154L14.1 sequences are listed. 293 cells were transfected with miR‑Con or miR‑548ao‑3p mimics, in combination with a reporter vector containing RP11‑156L14.1‑wt or RP11‑156L14.1‑mut sequences. Relative luciferase activity was measured 48 h later. (D) Ago2 immunoprecipitation experiments were performed in FaDu cells, and IgG was used as a control. The relative expression of RP11‑156L14.1 or miR‑548ao‑3p was determined by qPCR. (E) FaDu cells were transfected with RP11‑156L14.1 knockdown vector, along with si‑NC control vectors. The relative expression of RP11‑156L14.1 or miR‑548ao‑3p was determined by qPCR. (F) The relative expression of miR‑548ao‑3p in HSCC tumor tissues and adjacent non‑tumor tissues was determined by qPCR. (G) The relative expression of miR‑548ao‑3p in HSCC cell lines and normal tissues was determined by qPCR. *P<0.05, **P<0.01, ***P<0.001. lncRNA, long non‑coding RNA; HSCC, hypopharyngeal squamous cell carcinoma; wt, wild‑type; qPCR, quantitative PCR.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Fractionation, Expressing, Transfection, Luciferase, Negative Control, Activity Assay, Binding Assay, Plasmid Preparation, Immunoprecipitation, Control, Knockdown, Real-time Polymerase Chain Reaction

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 5. RP11‑156L14.1 promotes cell proliferation and the cell cycle via miR‑548ao‑3p in HSCC cells. SAS or FaDu cells were transfected with si‑NC+miR‑Ctrl, si‑RP11‑156L14.1+miR‑Ctrl, or si‑RP11‑156L14.1+miR‑548ao‑3p inhibitor. (A and B) The relative expression of miR‑548ao‑3p was assessed by RT‑qPCR 48 h later. SAS or FaDu cells were transfected with si‑NC+miR‑Ctrl, si‑RP11‑156L14.1+miR‑Ctrl, si‑NC+miR‑548ao‑3p inhibitor, or si‑RP11‑156L14.1+miR‑548ao‑3p inhibitor. (C and D) Cell proliferation was determined with the CCK‑8 assay at the indicated time‑points. (E) DNA synthesis was measured by EdU staining. (F) Flow cytometric analyses of the cell cycle in SAS or FaDu cells stained with propidium iodide. **P<0.01, ***P<0.001. HSCC, hypopharyngeal squamous cell carcinoma; RT‑qPCR, reverse transcription‑quantitative PCR; CCK‑8, Cell Counting Kit‑8.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Transfection, Expressing, CCK-8 Assay, DNA Synthesis, Staining

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 6. RP11‑156L14.1 promotes migration, invasion, and EMT via miR‑548‑3p in HSCC cells. SAS or FaDu cells were transfected with si‑NC+miR‑Ctrl, si‑RP11‑156L14.1+miR‑Ctrl, si‑NC+miR‑548ao‑3p inhibitor, or si‑RP11‑156L14.1+miR‑548ao‑3p inhibitor. (A and B) Wound‑healing assays were conducted to evaluate the cell migration of SAS and FaDu cells. (C and D) Transwell assays were performed to assess cell migration and invasion in SAS and FaDu cells. (E) EMT‑related proteins E‑cadherin, N‑cadherin, and vimentin were determined by western blotting in SAS and FaDu cells. β‑actin was used as an internal control. The experiment was repeated three times, and the representative blot images are presented. *P<0.05, **P<0.01, ***P<0.001. EMT, epithelial‑mesen- chymal transition; HSCC, hypopharyngeal squamous cell carcinoma.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Migration, Transfection, Western Blot, Control

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 7. RP11‑156L14.1 functions as a ceRNA in regulating SSR1 expression by binding to miR‑548ao‑3p. (A and B) Bioinformatics analyses predicted putative binding sequences between WT SSR1 3'‑UTR and miR‑548ao‑3p. The mutated SSR1 3'‑UTR sequences are listed. (C) 293 cells were transfected with control mimics or miR‑548ao‑3p mimics, in combination with reporter vectors containing Wt 3'‑UTR SSR1 or mutated 3'‑UTR of SSR1 sequences. Relative luciferase activity was measured 48 h later. (D) SAS or FaDu cells were transfected with pcDNA3.1 control, pcDNA3.1‑RP11‑156L14.1, or pcDNA3.1‑RP11 ‑156L14.1+miR‑548ao‑3p mimics, and the protein levels of SSR1 were analyzed. β‑actin was used as an internal control. The experiment was repeated three times, and the representative blot images are presented. (E) Relative expression of SSR1 in HSCC tumor tissues and adjacent non‑tumor tissues was determined by qPCR. (F) Relative expression of SSR1 in HSCC cell lines and normal control cell was determined by qPCR. *P<0.05, **P<0.01, ***P<0.001. SSR1, signal sequence receptor subunit 1; WT, wild‑type; HSCC, hypopharyngeal squamous cell carcinoma; qPCR, quantitative PCR.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Expressing, Binding Assay, Transfection, Control, Luciferase, Activity Assay, Sequencing, Real-time Polymerase Chain Reaction

Journal: Oncology reports

Article Title: RP11‑156L14.1 regulates SSR1 expression by competitively binding to miR‑548ao‑3p in hypopharyngeal squamous cell carcinoma.

doi: 10.3892/or.2020.7762

Figure Lengend Snippet: Figure 8. RP11‑156L14.1 knockdown inhibits HSCC tumor growth in vivo. FaDu cells were transfected with sh‑NC or sh‑RP11‑156L14.1 and then implanted subcutaneously into nude mice to develop tumors. (A) Images of tumor tissues from the sh‑NC and sh‑RP11‑156L14.1 groups were obtained on day 13. (B) The growth curves of the tumor volume in nude mice were measured at the indicated time‑points. (C and D) The volumes and weights of tumors from the sh‑NC and sh‑RP11‑156L14.1 groups were measured on day 13. (E) The expression levels of miR‑548ao‑3p in the tumor tissues from the sh‑NC and sh‑RP11‑156L14.1 groups were analyzed by RT‑qPCR. (F‑H) The relative mRNA and protein expression levels of SSR1 in the tumor tissues from the sh‑NC and sh‑RP11‑156L14.1 groups were determined by RT‑qPCR and western blotting. Data are presented as the mean ± SD. *P<0.05, **P<0.01. HSCC, hypopharyngeal squamous cell carcinoma; RT‑qPCR, reverse transcription‑quantitative PCR.

Article Snippet: The HSCC cell lines FaDu (derived from a primary lesion of hypopharyngeal SCC), SAS (derived from a primary lesion of tongue SCC), and HSC3 (derived from lymph node metastasis of tongue SCC) were obtained from American Type Culture Collection (ATCC).

Techniques: Knockdown, In Vivo, Transfection, Expressing, Western Blot

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The in vitro targeting efficiency from confocal microscopy (( A ) bar = 10 μm) and flow cytometry ( B ) analysis after incubating U87 cells with 5(6)-carboxyfluorescein (5(6)-FAM)-labeled PLGA magnetic nanoparticles (PMNP) and (5(6)-FAM)-labeled HA-coated PLGA magnetic nanoparticles (HA/PMNP) for 24 h. The cytoskeleton was labeled with phalloidin-TRITC (red) and the nucleus was counterstained with DAPI (blue).

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: In Vitro, Confocal Microscopy, Flow Cytometry, Labeling

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: ( A ) The cytocompatibility of HA/PMNP by incubating different concentrations of nanoparticles with U87 cells for 24, 48, and 72 h and determining the cell viability by MTT assays. The control is cell culture medium. * p < 0.05 compared with 24 h. ( B ) The cytotoxicity of CDDP, CDDP-loaded PLGA magnetic nanoparticles (PMNPc), and HA-modified PMNPc (HA/PMNPc) after incubating with U87 cells for 72 h and determining the cell viability by MTT assays. * p < 0.05 compared with CDDP, # p < 0.05 compared with PMNPc.

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Control, Cell Culture, Modification

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The cytotoxicity of CDDP, CDDP-loaded PLGA magnetic nanoparticles (PMNPc), and HA-coated PMNPc (HA/PMNPc) after incubating with U87 cells for 72 h. The cell apoptosis/necrosis was determined by flow cytometry analysis using Annexin V-FITC/PI staining. Q1: live; Q2: early apoptosis; Q3: late apoptosis; Q4: necrosis. The tested drug concentration is 0.5 μg/mL.

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Flow Cytometry, Staining, Concentration Assay

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: ( A ) The expression of apoptosis marker proteins by U87 cells from Western blot analysis after incubating with CDDP, CDDP-loaded PLGA magnetic nanoparticles (PMNPc), and HA-coated PMNPc (HA/PMNPc) for 72 h. ( B ) The semi-quantitative analysis of Western blot results. The tested drug concentration is 0.5 μg/mL. * p < 0.05 compared with PMNPc; # p < 0.05 compared with CDDP; & p < 0.05 compared with HA/PMNPc.

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Expressing, Marker, Western Blot, Concentration Assay

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The cytotoxicity after treating U87 cells with PBS, or HA-coated PLGA magnetic nanoparticles (HA/PMNP) in PBS for 24 h followed by 880 nm near-infrared (NIR) laser irradiation. ( A ) The cell viability from MTT assays after 2 min laser irradiation. * p < 0.05 compared with HA/PMNP. ( B ) The quantification of cell apoptosis and necrosis by flow cytometry after 2 min laser irradiation with Annexin V-FITC/PI staining. Q1: live; Q2: early apoptosis; Q3: late apoptosis; Q4: necrosis. ( C ) The Western blot analysis of heat-shock protein 70 (HSP70). ( D ) The semi-quantitative analysis of production of HSP70 from Western blot. * p < 0.05 compared with HA/PMNP; # p < 0.05 compared with HA/PMNP + Laser (2 min).

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Irradiation, Flow Cytometry, Staining, Western Blot

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The biodistribution of Cy5.5-labeled HA/PMNPc in U87 tumor-bearing nude mice was determined by injecting 100 μL PBS or HA/PMNPc nanoparticles through the tail vein with (M+) or without (M−) magnetic targeting, using a magnet at the tumor area (n = 1). The in vivo imaging system (IVIS) was used for ex vivo imaging of explanted organs and tumors after 4 h ( A ), and quantification of distribution of nanoparticles was calculated based on fluorescence intensity in each organ as well as tumor ( B ).

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Labeling, In Vivo Imaging, Ex Vivo, Imaging, Fluorescence

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: ( A ) The thermal images using an infrared camera, and ( B ) the time-dependent peak temperature profiles in the tumor area of U87 tumor-bearing nude mice after 808 nm NIR laser irradiation. The HA/PMNPc solution (100 μL) was used for intravenous injection, followed by magnetic targeting with a magnet and NIR laser irradiation at the tumor area.

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Irradiation, Injection

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The body weight change during treatment of U87 xenograft tumors in nude mice ( A ). The treatment efficacy was followed from bioluminescence imaging (BLI) by an in vivo imaging system (IVIS) ( B ). The distribution of normalized BLI signal intensity on days 28 and 32 ( C ), and the comparison of normalized BLI values (mean ± SD, n = 5) ( D ). Group: A, PBS; B, CDDP; C, HA/PMNPc (M-/L−); D, HA/PMNPc (M+/L−); E, HA/PMNPc (M/+L+). * p < 0.05.

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques: Imaging, In Vivo Imaging, Comparison

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The treatment of U87 xenograft tumors in nude mice was followed by the change in tumor size with the gross view of tumors on day 28 ( A ), the tumor size on day 28 and day 32 ( B ), the change in tumor size (mean ± SD, n = 5) ( C ), and the survival curve ( D ). Group: A, PBS; B, CDDP; C, HA/PMNPc (M−/L−); D, HA/PMNPc (M+/L−); E, HA/PMNPc (M/+L+). * p < 0.05.

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques:

Journal: Pharmaceutics

Article Title: Hyaluronic Acid-Modified Cisplatin-Encapsulated Poly(Lactic-co-Glycolic Acid) Magnetic Nanoparticles for Dual-Targeted NIR-Responsive Chemo-Photothermal Combination Cancer Therapy

doi: 10.3390/pharmaceutics15010290

Figure Lengend Snippet: The survival times for U87 tumor-bearing mice after different treatments (n = 5).

Article Snippet: The U87 human primary glioblastoma cell line (ATCC HTB1) was obtained from American Type Culture Collection (Manassas, VA, USA) and genetically modified with firefly luciferase gene by lentiviral infection.

Techniques:

Journal: Scientific reports

Article Title: Intestinal IL-25 prevents high-fat diet-induced obesity by modulating the cholesterol transporter NPC1L1 expression in the intestinal epithelial cells.

doi: 10.1038/s41598-025-95516-7

Figure Lengend Snippet: Fig. 3. The association between intestinal IL-25 expression and the systemic and intestinal metabolic changes in high-fat diet-induced obesity. BALB/c mice were fed with NCD or HFD for 8 weeks. The alteration of intestinal cytokine gene expression was determined and associated with various metabolic parameters. (A) Quantitative real-time PCR analysis of proinflammatory cytokine (Tnfa) and epithelial cell- derived cytokines (Il25, Tslp, Il33) in the jejunum of NCD-and HFD-fed mice. The mRNA expression data are presented as fold induction over actin (Actb) expression, with the mRNA levels in NCD-fed mice set as 1. Graphs depict mean ± SD of three independent experiments, with n = 6 mice per group. Significance was determined using Student’s t-test analysis. (B) The correlation between plasma glucose, total cholesterol (TC), and triglycerides (mg/dL) and the mRNA expression levels of intestinal cytokines Tnfa (upper row) and Il25 (bottom row), with n = 10 mice from HFD group was analyzed using Spearman’s rank test. (C) The association between the expression level of Il25 gene and genes related to glucose and lipid absorption in the jejunum, including Sglt1, Npc1l1, Fatp4, Cd36, with n = 10 mice from HFD group was analyzed using Spearman’s rank test. Correlation coefficients (r) and p values are provided. (*p < 0.05, **p < 0.01)

Article Snippet: Human epithelial cell lines (Caco-2 cells, ATCC HTB-37) were grown in high-glucose Dulbecco’s Modified Eagle Medium (DMEM, GibcoTM), supplemented with 10% heat-inactivated fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S).

Techniques: Expressing, Gene Expression, Real-time Polymerase Chain Reaction, Derivative Assay, Clinical Proteomics